WelcomeUser Guide
ToSPrivacyCanary
DonateBugsLicense

©2025 Poal.co

(post is archived)

[–] 1 pt

wrong.... the Clot-Shot DOES in fact alter DNA in many 2021 non-peer reviewed but detailed papers, albeit a ridiculously short little sequence, and also in some 2022 reviewed papers.

Recently more and more papers come out about small changes to DNA from a variety of mechanisms.

also :

Jan 24 2022 : SARS-CoV-2 spike protein activates human endogenous retroviruses in blood cells https://phys.org/news/2022-01-sars-cov-spike-protein-human-endogenous.html

doi: https://doi.org/10.1101/2022.01.18.21266111 https://www.medrxiv.org/content/10.1101/2022.01.18.21266111v2

https://www.thelancet.com/journals/ebiom/article/PIIS2352-3964(21)00134-1/fulltext

https://twitter.com/TheChiefNerd/status/1485695818996854788

https://archive.4plebs.org/pol/thread/358982609/#358982609

clot shot seizures : THAT MEANS ITS WORKING https://youtu.be/lV81IUQS9w0

[–] 0 pt (edited )

twitter link is dead btw

spike protein

this can also be triggered by just covid, same for the epilepsy videos

not seeing anything specific about vaccines changing cell DNA in the nucleus, it's just affecting B cells which are only responsible for the immune system.

[–] 1 pt (edited )

My meme is comedy, not news , it is factual though.

https://archive.fo/QpJk0
https://archive.fo/wHoBf

A Science paper:

Here is the first of many such papers. This was a PREPRINT from 2020 December (December 13, 2020) prior to peer review. Yes it is that old.

https://files.catbox.moe/mg9m18.pdf

If they did use real SARS-2 sample, however impure, they did show extremely slight viral insertion into DNA, which means it can be immortalized into Human egg cell or sperm cells and become part of every cell of newborn human. Like Viruses for 1,000,000 years inside human DNA, all broken, fragmented, inert, and incapable of escape (hopefully). All mammals have old virus trapped inside your DNA when born, and one day it might be scary as its an "anchor" a second CRISPR-Cas9 virus could piggyback on to melt a human in 40 minutes from "lysing" a whole being one day.

Mammals Carry a Graveyard of Viruses in Our DNA, And It Could Have a Crucial Purpose: https://www.msn.com/en-au/news/techandscience/mammals-carry-a-graveyard-of-viruses-in-our-dna-and-it-could-have-a-crucial-purpose/ar-AAOli2T

Viruses rarely invade egg cells but as you can see in that link, we know it happens sometimes.

this paper got a hyperactive immortal tumor kidney cell from female fetus in 1973 to show SLIGHT viral recombination

Using amped-up PCR using NOW FRAUDULENT PCR primer source from WHO (Influenza-A and B), this paper got a hyperactive immortal tumor kidney cell from female fetus in 1973 to show SLIGHT viral recombination.

They do however claim 600% higher measurement of "glowing" than control for this claim :

We conducted single-molecule RNA-FISH (smRNA-FISH) using fluorophore-labeled oligo-nucleotide probes targeting N (Fig. 2a) to confirm that viral N sequences were integrated and detected their transcription in the nucleus. SARS-CoV-2 infected cells showed the expected cytoplasmic FISH signals of N RNA (Fig. S3a).

Keep in mind the length of piece they injected was laughably short and common to many virus species : here it is in full "GACCCCAAAATCAGCGAAAT"

yup! Thats how many base pairs they inserted and say its reverse of : "TCTGGTTACTGCCAGTTGAATCTG"

A statistician might roll their eyes at that, but they do claim 600% more presence over background control noise, but I bet DNA has methods of shedding some garbage like that, or neutering it by palindromic gibberish fold backs, or blasting it with base pair mutations, or losing it in 'recombination in meiosis' and preferring other side strand gene, or by affixing inhibiting histone body onto the viral interloper to restrict its ability to create proteins. All of my claims are just uplifting wishful thinking, but I'll be fucking damned if I believe evolution has no defense from tiny trivial sequence "GACCCCAAAATCAGCGAAAT" invading human dna and getting free reign that easily!

So in summary, the already very short single strand SARS-2 virus CANNOT lyse out nor be formed from copies entombed into DNA, but SMALL pernicious common Virus parts ARE slightly sometimes in VERY SMALL FRAGMENTS inserted into DNA of cells and reproduced, and one day shed from apoptosis (normal cell death).

This article, if rewritten, would have to use the new Post Dec 21st 2021 CDC Isolate of SARS-2, would have to also use three PCR test references to eliminate Influenza-A and Influenza-B. HIV is expected too as it has 4 copies on the tiny short SARS-2 Wuhan man-made bioweapon research virus. 4 copies!!!

I propose they had contamination of Influenza-A and B that they tagged and inserted and measured back, and they ADMITTED they only got tiny fragment pieces inserted into human DNA... and very very abnormal IMMORTAL DNA with provably 100s of anomalies since 1973.

SO THAT IS ONE PAPER showing that "GACCCCAAAATCAGCGAAAT" is indeed provably inserted into human DNA using official , now-retracted, CDC primers for SARS-2 , in Dec 2020, and OTHER PAPERS since show DNA insertions.

= = = = = = =

The CLOT-SHOT not only slightly changes human DNA, it RUINS immune system, allowing many cancers to start, which by definition is "allowing your DNA to change in unwanted ways" due to loss of CD8 T-Cells that destroy DNA altered micro tumors that are cancerous.

NOTE THE CD8 T-Cell type column!!!

https://files.catbox.moe/vbyn6o.jpg

See? I annotated it. It concurs with many large studies.

CD8 starts above norm healthy then DEVASTATED!!!! Look at range column! Sub acceptable CD8 T-cell type!

CD8 kills off little cancers found in body early. 40% of CD8 are gone for a year or more after you take a clot-shot.

Without CD8 , anal cancer will spike, HPV cancer, cervical cancer.

Immuno-oncologists have discovered that T-cells also seek and destroy cancer cells all the time, which keeps the body in a state of equilibrium.

The discovery of the role the immune system plays in fighting cancer highlights the importance of T-cells recognizing cancer cells as invaders.

Immuno-oncology

US Cancer Statistics dataset for 2020 and 2021 are shoahed : United States Cancer Statistics (USCS)

https://www.cdc.gov/cancer/uscs/dataviz/download_data.htm

HPV cancers like 'Squamous cell carcinoma of the anus (SCCA)' will be the one to watch in jabbed vs unjabbed

and 'average annual percentage change (AAPC)' for next month vs last year or year before same month.

But 2019 is now offline at CDC. Shoahed due to the volcano brewing in the jabbed for cancers about to skyrocket.

Other US cancer registries exist though. As do other nations.

Squamous cell carcinoma of the anus (SCCA) is the most common histologic subtype of anal cancer, and more than 90% of incident cancers are associated with human papillomavirus (HPV) , thus I predict , if HONEST database records, a 100% or more jump in SCCA cancer in MAY 2022 vs MAY 2019.

= = = = = =

I was RIGHT in my old over half a year ago prediction!:

US Military snitch tweet this wee Jan 25 2022, from one cancer tally of "billing codes" database :

https://files.catbox.moe/utd787.jpeg

The news in more detail.

https://www.theblaze.com/op-ed/horowitz-whistleblowers-share-dod-medical-data-that-blows-vaccine-safety-debate-wide-open

= = = = = =

CLOT SHOT ruins immune system for months or years!

Mayo Clinic-trained Doctor Says Covid-19 Vaccines Suppress the Immune System, Making People More Prone to HIV, Shingles and Herpes

CD8 cells

https://dailyexpose.uk/2021/11/22/mayo-clinic-trained-doctor-says-covid-19-vaccines-suppress-the-immune-system-making-people-more-prone-to-hiv-shingles-and-herpes/

WOW!

Dr Cole added that he has also seen a massive spike in cancer. He warns that there is now 20 times the normal average of certain types of cancers ever since the Covid-19 vaccine programme started.

“Now most concerning of all is there’s a pattern of these types of immune cells in the body that keep cancer in check,” Dr. Cole says. “Well, since January 1 in the laboratory I’ve seen a 20 times increase of endometrial cancers over what I see on an annual basis – a 20 times increase and I’m not exaggerating at all.”

= = = =

Jabbed people have barely any functioning immunity.

https://thenationalpulse.com/2021/12/31/vaccinated-21-times-more-likely-to-get-omicron

Over 95 percent of reported cases of the Omicron COVID-19 variant in Germany
occurred in fully vaccinated individuals, according to a new report from the
federal government.

The paper – published December 30th by the German agency the ‘Robert Koch
Institute’ – included information on the vaccination status of 4,206
individuals who contracted the latest variant of the virus.

https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/Situationsberichte/Wochenbericht/Wochenbericht_2021-12-30

https://files.catbox.moe/azc5dr.pdf

= = =

The CLOT-SHOT makes you MORE LIKELY to get SARS-2 (covid-19), proven in over 12 nations.

Over 95 percent of reported cases of the Omicron COVID-19 variant in Germany
occurred in fully vaccinated individuals, according to a new report from the
federal government.

The paper – published December 30th by the German agency the ‘Robert Koch
Institute’ – included information on the vaccination status of 4,206
individuals who contracted the latest variant of the virus.

https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/Situationsberichte/Wochenbericht/Wochenbericht_2021-12-30

https://files.catbox.moe/azc5dr.pdf

Four thousand and twenty people who reported contracting Omicron in the study
– which equates to 95.6 percent of total cases – had received at least two
doses of COVID-19 vaccines. Twenty-eight percent of the Omicron-positive group
had also received a third dose or “booster” shot.

Just 186 people contracting Omicron were unvaccinated in the entire sample,
showing that vaccinated individuals were over 21 times as likely to contract
the COVID-19 variant.

“For 6,788 cases, information on the symptoms was provided, mostly no or mild symptoms were reported. 124 patients were hospitalized, four people died.”

= = = = =

Dec 7 2021 : 90% in ICU for covid were CLOT SHOT JABBED!!!!

85% jabbed in wales!

https://files.catbox.moe/jcjou3.jpeg

= = = =

100% jabbed in Gibralter! holy shit
Dec 1 Gibralter 100% vaccinated Pfizer shot gets 60 new covid-19 cases per DAY!

Gibraltar proves that vaccination does not stop Covid
https://livebeyondborders.substack.com/p/gibraltar-proves-that-vaccination

Among those over 60 years of age, the share of the vaccinated Covid cases is even 92%.
https://twitter.com/GibraltarGov

= = = =
= = = =
CDC: Only 21% Of Omicron Cases Occurred In Unvaccinated People1
https://www.dailywire.com/news/cdc-only-20-of-omicron-cases-occurred-in-unvaccinated-people

Just 20% of COVID-19 cases caused by the Omicron variant, based on an examination of diagnoses from December 1-8.
There were 43 cases attributed to Omicron; 34 were among people who had been “fully vaccinated.”
What’s more, one-third of the 34 had also received a third “booster” shot. Just one of those suffering from Omicron was briefly hospitalized.

the Clot-Shot SPREADS SARS-2 (COVID-19)!

(NEWS) 2021.11.29 : CDC-funded study: COVID shots have no effect on virus transmission! (in fact the Clot-Shot SPREADS SARS-2 (COVID-19) !! No effect now Proven! Other larger studies concur. (www.wnd.c

https://www.medrxiv.org/content/10.1101/2021.11.12.21265796v1.full.pdf

https://www.wnd.com/2021/11/4964327/

https://www.wnd.com/2021/10/lancet-study-vaccinated-likely-unvaccinated-spread-delta-variant/

= = = =

NEGATIVE vaccine efficacy

New studies show that the COVID vaccines damage your immune system, likely permanently

The vaccines are making it more likely you'll be infected with Omicron 90 days after you are fully vaccinated. To keep vaccine effectiveness high against omicron, vaccination every 30 days is needed, or else never get a vaccination for more protection

Update Jan 7, 2022: The numbers in the Denmark study described below are now confirmed by government data from Germany showing that vaccinated people are 8X more likely to develop Omicron than unvaccinated people.

https://dailyexpose.uk/2022/01/02/german-gov-data-suggests-fully-vaccinated-developing-ade/

This study shows that after three months the vaccine effectiveness of Pfizer & Moderna against Omicron is actually negative. Pfizer customers are 76.5% more likely and Moderna customers are 39.3% more likely to be infected than unvaxxed people.

https://www.medrxiv.org/content/10.1101/2021.12.20.21267966v2.full.pdf+html

https://twitter.com/ezralevant/status/1474106318206255113?s=21

https://stevekirsch.substack.com/p/new-study-shows-vaccines-must-be

= = = =

This is not surprising since a paper from Germany showed the same thing: the more you vaccinate, the worse it gets.

https://stevekirsch.substack.com/p/new-study-from-germany-confirms-higher Worried about Omicron? Guess what? After 90 days, the vaccine they gave you is going to make you MORE likely to get infected from Omicron, not less. The longer you stay on the vaccine treadmill, the harder to get off in the future and the easier you’ll make it for the virus.

= = = =

Jan 11 2022 : Massive 145-Country Study Shows Sharp INCREASE Of Transmission And DEATH After Introduction Of COVID Vaccines
https://seemorerocks.is/massive-145-country-study-shows-sharp-increase-of-transmission-and-death-after-introduction-of-covid-vaccines/
38% more Covid cases per million – and an even more astonishing 31% increase in deaths per million

https://www.researchgate.net/profile/Kyle-Beattie/publication/356248984_Worldwide_Bayesian_Causal_Impact_Analysis_of_Vaccine_Administration_on_Deaths_and_Cases_Associated_with_COVID-19_A_BigData_Analysis_of_145_Countries/links/61931b0507be5f31b78710a8/Worldwide-Bayesian-Causal-Impact-Analysis-of-Vaccine-Administration-on-Deaths-and-Cases-Associated-with-COVID-19-A-BigData-Analysis-of-145-Countries.pdf https://files.catbox.moe/4xk9zy.pdf

= = = = =

1 in 191 died from vaxx at age 60 and over

December 17, 2021 = Relationship Between Covid-19 Vaccination and All Cause Mortality https://hatchardreport.com/relationship-between-covid-19-vaccination-and-all-cause-mortality/

As weekly vaccination numbers rise to a peak, deaths peak.

As vaccination numbers begin to fall, deaths also fall.

https://www.youtube.com/watch?v=VVxmAIKjYM4

= = = = =

Nobody dies "from" covid. It's either WITH covid or from the vaccine

First 6 months of 2021 England :

https://files.catbox.moe/rac2gk.png

= = = =

But the JEW media calls the jabbed "UNVACCINATED PEOPLE" for the last 3 weeks because the goal posts shifted to THREE or FOUR clot-shots to be called "vaccinated" !!!!

hah ahha hahhah hah hah hah!

Truth: ONLY the clot-shot jabbed so far got OMICRON, and luckily for them its jus sniffles.

JEWS ARE TRYING TO PASS EMERGENCY no-ID voting and MAIL IN VOTING only for 2022 midterms to ruin the remains of the USA with jew marxism!

Its more democrat jew tricks!

omicron is a leftist trick!

and if you want to stay healthy, be a PURE BLOOD!

And vote these democrat fuckheads out of office.

TL/DR: You are seething and coping because you were a moron and took the CLOT-SHOT and are biased and ignorant to science facts. The clot-shot can result in tiny DNA inserts into human cells, and impedes CD8 T-Cell killing of cancerous DNA inserted cells and mutated cells.